TaqMan Real-Time PCR Amplification Procedure for P. ramorum
TaqMan Real-Time PCR Amplification Procedure for P. ramorum The following procedure is the TaqMan real-time PCR amplification procedure for P. ramorum as reported in Tooley et al. (2006). The P. ramorum species-specific primer pair and the internal control plant primer pair are the same used for the conventional nested PCR amplification procedure. Species specific primer pairs for other Phytophthora spp. have been developed (list of species, sequence alignment used for primer development - .msf, .nex, fastA)
Tooley, P.W., Martin, F.N., Carras, M.M. and Frederick, R.D. (2006) Real-time fluorescent PCR detection of Phytophthora ramorum and Phytophthora pseudosyringae using mitochondrial gene regions. Phytopathology 96: 336-345 (pdf reprint)
Modifications to amplification procedure
· Potential alternative plant primers
· Conventional PCR detection of P. ramorum Amplification Conditions The following amplification procedures used TaqMan universal master mix, when BioRad master mix was used instead background amplification of 5 additional species was observed
- Amplification conditions were
- An additional 0.5 mM MgCl2 was added to the master mix
- FMPr-1a, FMpr-7 used at 1,000 nM final concentration
- TaqMan probe PrFAM used at 400 nM final concentration
- FMPl2b, FMpl3b used at 100 nM final concentration
- TaqMan probe Plant CALOrange used at 80 nM final concentration
- Primers
Target |
Primer/probe |
Sequence (5’ to 3’ ) |
Length |
Tma |
%GCb |
P. ramorum |
FMPr-1a |
GTATTTAAAATCATAGGTGTAATTTG |
26 |
50.0 |
23.1 |
P. ramorum |
FMPr-7 |
TGGTTTTTTTAATTTATATTATCAATG |
27 |
51.9 |
14.8 |
P. ramorum |
PrFAM probe |
6-FAM d(CAGATATTAAACAAATTATATATAAAATCAAACAA) BHQ-1c |
35 |
56.2 |
14.3 |
Plant |
FMPl-2b |
GCGTGGACCTGGAATGACTA |
20 |
57.2 |
55 |
Plant |
FMPl-3b |
AGGTTGTATTAAAGTTTCGATCG |
23 |
53.5 |
34.8 |
Plant |
Plant CALOrange probe |
CAL Orange d(CTTTTATTATCACTTCCGGTACTGGCAGG) BHQ-1 |
29 |
64.5 |
44.8 |
P. pseudosyringae |
FMPps1c |
AGTTTCATTAGAAGATTATTTAC |
23 |
52.1 |
21.7 |
P. pseudosyringae |
FMPps2c |
AAAATTGTTTGATTTTATTAAGTATC |
26 |
52.0 |
15.4 |
P. pseudosyringae |
PpsCALOrange probe |
CAL Orange d(TTAATAAAAAAATTATGATATTTAAACTAATTGGT) BHQ-1 |
35 |
56.3 |
11.4 |
Cycling conditions
50 C for 2 minutes 95 C for 10 minutes 60 cycles of 95 C for 15 sec and 55 C for 1 minute
Comments on amplification
- The limit of detection when using purified culture DNA is 1 fg
- The amplification can be 3 way multiplexed (plant control, P. ramorum and P. pseudosyringae)
- Reaction volume was 50 µl
- an additional 75 μM dNTPs was added to the master mix
- the plant probe was used at 400 nM final concentration
- DNA extracted from an artificially inoculated rhododendron leaf gave a positive result when diluted down as far as 10-5 (extrapolated to represent 1.7 fg pathogen DNA)
- Positive results were also obtained with 10-6 dilutions, but with Ct values of 55.3 and were outside of the linear portion of the regression line
- The real time PCR master mix can have an effect on the specificity of the marker
- ABI TaqMan master mix worked well, but switching to BioRad caused 5 species to give a false positive
|